Hi Donielle, You must start your strand with AUG and end it with UAG to get points :) But I believe what it says is: students become sleepy from study about anthropology because it is confusing.
HI Donielle, I think she's right about the start and stop codons, but also I think you still have to transcribe this into DNA. This code is mRNA because it uses Uracil. DNA doesn't use Uracil so i don't think our DNA postings shouldn't have any U's in them at all.
This is why I asked for help from the instructor because I did not understand exactly how to do this. So I will just have to take my score. Since @ this point I don't have time to redo this because I am still not sure how to do this 100%.
Good try, Kristy, and the input is appreciated, Pans.
Donielle, as has been pointed out, you only got as far as the RNA. The sentence works and the reverse translation into RNA was correct, but you needed to keep going with the instructions to reverse-transcribe into DNA to finish the assignment.
Based upon your sentence, this is the process you should have done to complete this assignment:
Sentence: Students become sleepy from study(ing) about anthropology because it is confusing.
Reverse-translate to RNA (which you did correctly): AUU CCU GAG UAC CCG UCG AAC UUA UGA CUU GCG
Add start and stop codons to the RNA and take away the spaces: AUGAUUCCUGAGUACCCGUCGAACUUAUGACUUGCGUAG
Reverse-transcribe to DNA (review the assignment for specifics on how to do this): TACTAAGGACTCATGGGCAGCTTGAATACTGAACGCATC
Add the random bases at the beginning and end to make your decoder look for the start and stop codons: ATAGCTACTAAGGACTCATGGGCAGCTTGAATACTGAACGCATCGCCATAA
That last line is what you should have posted on your blog.
I recommend that you take a few student posts and decode them on your own just for practice. DON'T post a comment, but you can just use them to practice. Email me if you are still confused about any of this.
Hi Kristy, You obviously got it right! LOL As you can tell from all the help I needed from the instructor. Unfortunately I still am not completely understanding how to do this and I have been over EVERY blog that has Dr. Rodriguez's seal of approval on it and even those that needed work done like mine. Thank you for your input!! (Both of you)
Hi Donielle,
ReplyDeleteYou must start your strand with AUG and end it with UAG to get points :)
But I believe what it says is: students become sleepy from study about anthropology because it is confusing.
HI Donielle, I think she's right about the start and stop codons, but also I think you still have to transcribe this into DNA. This code is mRNA because it uses Uracil. DNA doesn't use Uracil so i don't think our DNA postings shouldn't have any U's in them at all.
ReplyDeleteThis is why I asked for help from the instructor because I did not understand exactly how to do this. So I will just have to take my score. Since @ this point I don't have time to redo this because I am still not sure how to do this 100%.
ReplyDeleteGood try, Kristy, and the input is appreciated, Pans.
ReplyDeleteDonielle, as has been pointed out, you only got as far as the RNA. The sentence works and the reverse translation into RNA was correct, but you needed to keep going with the instructions to reverse-transcribe into DNA to finish the assignment.
Based upon your sentence, this is the process you should have done to complete this assignment:
Sentence: Students become sleepy from study(ing) about anthropology because it is confusing.
Reverse-translate to RNA (which you did correctly):
AUU CCU GAG UAC CCG UCG AAC UUA UGA CUU GCG
Add start and stop codons to the RNA and take away the spaces: AUGAUUCCUGAGUACCCGUCGAACUUAUGACUUGCGUAG
Reverse-transcribe to DNA (review the assignment for specifics on how to do this):
TACTAAGGACTCATGGGCAGCTTGAATACTGAACGCATC
Add the random bases at the beginning and end to make your decoder look for the start and stop codons:
ATAGCTACTAAGGACTCATGGGCAGCTTGAATACTGAACGCATCGCCATAA
That last line is what you should have posted on your blog.
I recommend that you take a few student posts and decode them on your own just for practice. DON'T post a comment, but you can just use them to practice. Email me if you are still confused about any of this.
Hi Kristy, You obviously got it right! LOL As you can tell from all the help I needed from the instructor. Unfortunately I still am not completely understanding how to do this and I have been over EVERY blog that has Dr. Rodriguez's seal of approval on it and even those that needed work done like mine. Thank you for your input!! (Both of you)
ReplyDelete